Skip to main content
Addgene

pAAV/CMV-SCLM
(Plasmid #216758)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216758 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 61591)
  • Backbone size w/o insert (bp) 3481
  • Total vector size (bp) 6147
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SuperClomeleon followed by WPRE and human growth hormone polyA terminator
  • Alt name
    Cerulean/S30R/dC11-LE-Topaz/dN5/S30R/Q69T/V163A
  • Species
    A. victoria (crystal jelly)
  • Insert Size (bp)
    2666
  • Mutation
    S30R and 11 AA deletion in the Cerulean CFP moiety and 5 AA deletion, S30R, Q69T, and V163A in the Topaz YFP moiety
  • Promoter CMV (cytomegalovirus)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer ggctgttgggcactgacaat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV/CMV-SCLM was a gift from George Augustine (Addgene plasmid # 216758 ; http://n2t.net/addgene:216758 ; RRID:Addgene_216758)