pAV-puro-U6+27-F30-Tornado-Squash-FTL-IRE
(Plasmid
#216828)
-
PurposeExpresses a circular RNA containing a Squash aptamer and an IRE (FTL derived) in mammalian cells, using the Tornado expression system.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216828 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAV-puro-U6+27
- Backbone size w/o insert (bp) 5587
- Total vector size (bp) 5760
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTornado-Squash-FTL-IRE
-
SpeciesSynthetic
-
Insert Size (bp)173
- Promoter U6+27
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer GGAAGAGGGCCTATTTCCCAT
- 3′ sequencing primer CTAGTCCTCGGCTCGAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAV-puro-U6+27-F30-Tornado-Squash-FTL-IRE was a gift from Samie Jaffrey (Addgene plasmid # 216828 ; http://n2t.net/addgene:216828 ; RRID:Addgene_216828) -
For your References section:
Engineering acyclovir-induced RNA nanodevices for reversible and tunable control of aptamer function. Hagen T, Litke JL, Nasir N, Hou Q, Jaffrey SR. Cell Chem Biol. 2024 Aug 23:S2451-9456(24)00319-2. doi: 10.1016/j.chembiol.2024.07.017. 10.1016/j.chembiol.2024.07.017 PubMed 39191249