p35S-FHA-SpAGO4a_cDNA
(Plasmid
#216842)
-
PurposeN-term Flag-HA tagged Spirodela polyrhiza (Sp9509) AGO4a cDNA under regulation of CaMV 35S promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216842 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepB7WG2
- Total vector size (bp) 12065
-
Vector typePlant Expression
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameARGONAUTE4
-
Alt nameSpAGO4a
-
Alt nameSp9509d001g011250
-
SpeciesSpirodela polyrhiza
-
Insert Size (bp)2638
- Promoter CaMV 35S
-
Tag
/ Fusion Protein
- Flag-HA (N terminal on insert)
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer AAAAGCAGGCTTCATGGAT
- 3′ sequencing primer CTCACACATTATTCTGGAGA
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.04.03.587901 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p35S-FHA-SpAGO4a_cDNA was a gift from Arturo Marí-Ordóñez (Addgene plasmid # 216842 ; http://n2t.net/addgene:216842 ; RRID:Addgene_216842) -
For your References section:
Atypical epigenetic and small RNA control of degenerated transposons and their fragments in clonally reproducing Spirodela polyrhiza. Dombey R, Buendía-Ávila D, Barragán-Borrero V, Diezma-Navas L, Ponce-Mañe A, Vargas-Guerrero JM, Elias R, Marí-Ordóñez A. bioRxiv 2024.04.03.587901; doi: https://doi.org/10.1101/2024.04.03.587901 10.1101/2024.04.03.587901