SMT000
(Plasmid
#216849)
-
PurposePlasmid that encodes a sfGFP gene under a T7 promoter. Compatible with PURExpress for in vitro transcription/translation. Chloramphenicol resistant.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216849 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSB1C3
-
Backbone manufactureriGEM
- Backbone size w/o insert (bp) 1670
- Total vector size (bp) 2741
-
Modifications to backbonesfGFP gene inserted, T7 promoter added upstream of sfGFP
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSuperfolder Green Fluorescent Protein
-
Alt namesfGFP
-
SpeciesSynthetic; A. victoria
-
MutationS30R, Y39N, N105T, Y145F, I171V, and A206V
-
GenBank IDL29345.1
- Promoter T7
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ACCTCTTACGTGCCCGATCAAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe SMT000 plasmid was a gift from Akshay Maheshwari, Endy Lab, Stanford University.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.03.01.583031 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SMT000 was a gift from Polly Fordyce (Addgene plasmid # 216849 ; http://n2t.net/addgene:216849 ; RRID:Addgene_216849) -
For your References section:
FACS-Sortable Triple Emulsion Picoreactors for Screening Reactions in Biphasic Environments. Thompson S, Zhang Y, Yang Z, Nichols L, Fordyce PM. Adv Mater Interfaces. 2025 Feb 3;12(3):2400403. doi: 10.1002/admi.202400403. Epub 2024 Dec 4. 10.1002/admi.202400403 PubMed 40831677