pCLX-KRT7-GFP
(Plasmid
#216853)
-
PurposeThis plasmid is for the production of lentiviral vectors that can be used to identify and live sort pancreatic progenitor expresssing the Keratin7 gene.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216853 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCLX
- Backbone size w/o insert (bp) 8124
- Total vector size (bp) 8824
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
Insert Size (bp)700
- Promoter Keratin7
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gacaggcccgaaggaatagaag
- 3′ sequencing primer cgaccaggatgggcaccaccc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCLX-KRT7-GFP was a gift from Patrick Salmon (Addgene plasmid # 216853 ; http://n2t.net/addgene:216853 ; RRID:Addgene_216853)