pWPI-Glis3M412
(Plasmid
#216854)
-
PurposeThis plasmid is for the production of lentiviral vectors expressing an active form of Glis3 together with GFP.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216854 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepWPI
- Backbone size w/o insert (bp) 11200
- Total vector size (bp) 12796
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGlis3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1572
-
MutationN-terminal deletion removing repressor domains
-
Entrez GeneGlis3 (a.k.a. 4833409N03Rik, E330013K21Rik)
- Promoter EF1 alpha
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gatcttggttcattctcaag
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWPI-Glis3M412 was a gift from Patrick Salmon (Addgene plasmid # 216854 ; http://n2t.net/addgene:216854 ; RRID:Addgene_216854)