Skip to main content

pLenti-ePEG-LINE1-loxPsym
(Plasmid #216866)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216866 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti_epegRNA_acceptor
  • Backbone size w/o insert (bp) 8358
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    spacerLINE1_cr772scaffold_PBS-loxPsm-HA-tevopreQ
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-ePEG-LINE1-loxPsym was a gift from Leopold Parts (Addgene plasmid # 216866 ; http://n2t.net/addgene:216866 ; RRID:Addgene_216866)
  • For your References section:

    Randomizing the human genome by engineering recombination between repeat elements. Koeppel J, Ferreira R, Vanderstichele T, Riedmayr LM, Peets EM, Girling G, Weller J, Murat P, Liberante FG, Ellis T, Church GM, Parts L. Science. 2025 Jan 31;387(6733):eado3979. doi: 10.1126/science.ado3979. Epub 2025 Jan 31. 10.1126/science.ado3979 PubMed 39883775