pLenti-ePEG-LINE1-loxPsym
(Plasmid
#216866)
-
PurposeLentiviral guide RNA vector to insert the loxPsym sequence into LINE1 elements
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216866 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti_epegRNA_acceptor
- Backbone size w/o insert (bp) 8358
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namespacerLINE1_cr772scaffold_PBS-loxPsm-HA-tevopreQ
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-ePEG-LINE1-loxPsym was a gift from Leopold Parts (Addgene plasmid # 216866 ; http://n2t.net/addgene:216866 ; RRID:Addgene_216866) -
For your References section:
Randomizing the human genome by engineering recombination between repeat elements. Koeppel J, Ferreira R, Vanderstichele T, Riedmayr LM, Peets EM, Girling G, Weller J, Murat P, Liberante FG, Ellis T, Church GM, Parts L. Science. 2025 Jan 31;387(6733):eado3979. doi: 10.1126/science.ado3979. Epub 2025 Jan 31. 10.1126/science.ado3979 PubMed 39883775