Lenti-iStat3-BFP
(Plasmid
#216870)
-
PurposeLenti-iStat3-BFP plasmid contains the TRE (doxycycline inducible) promoter followed by the Stat3 mouse cDNA, a T2A and a Blue Fluorescent Protein (BFP) sequence.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216870 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLV-TRE
- Backbone size w/o insert (bp) 5968
- Total vector size (bp) 9629
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameStat3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2310
-
Entrez GeneStat3 (a.k.a. 1110034C02Rik, Aprf)
- Promoter Tetracycline-Response-Element (TRE)
-
Tag
/ Fusion Protein
- T2A-TagBFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGCTCAGTGGAACCAGCT
- 3′ sequencing primer CATGGGGGAGGTAGCACACT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-iStat3-BFP was a gift from Bernhard Payer (Addgene plasmid # 216870 ; http://n2t.net/addgene:216870 ; RRID:Addgene_216870) -
For your References section:
The interferon gamma pathway enhances pluripotency and X-chromosome reactivation in iPSC reprogramming. Barrero M, Lazarenkov A, Blanco E, Palma LG, Lopez-Rubio AV, Bauer M, Bigas A, Di Croce L, Sardina JL, Payer B. Sci Adv. 2024 Aug 9;10(32):eadj8862. doi: 10.1126/sciadv.adj8862. Epub 2024 Aug 7. 10.1126/sciadv.adj8862 PubMed 39110794