Skip to main content

Lenti-iStat3-BFP
(Plasmid #216870)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216870 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLV-TRE
  • Backbone size w/o insert (bp) 5968
  • Total vector size (bp) 9629
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Stat3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2310
  • Entrez Gene
    Stat3 (a.k.a. 1110034C02Rik, Aprf)
  • Promoter Tetracycline-Response-Element (TRE)
  • Tag / Fusion Protein
    • T2A-TagBFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGGCTCAGTGGAACCAGCT
  • 3′ sequencing primer CATGGGGGAGGTAGCACACT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-iStat3-BFP was a gift from Bernhard Payer (Addgene plasmid # 216870 ; http://n2t.net/addgene:216870 ; RRID:Addgene_216870)
  • For your References section:

    The interferon gamma pathway enhances pluripotency and X-chromosome reactivation in iPSC reprogramming. Barrero M, Lazarenkov A, Blanco E, Palma LG, Lopez-Rubio AV, Bauer M, Bigas A, Di Croce L, Sardina JL, Payer B. Sci Adv. 2024 Aug 9;10(32):eadj8862. doi: 10.1126/sciadv.adj8862. Epub 2024 Aug 7. 10.1126/sciadv.adj8862 PubMed 39110794