Skip to main content

pIAR008
(Plasmid #217023)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 217023 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pK18sB
  • Backbone size w/o insert (bp) 3038
  • Total vector size (bp) 4506
  • Modifications to backbone
    deletion of 45 bps during digestion and insert assembly
  • Vector type
    Bacterial gene replacement

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    50 μg/mL of kanamycin
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    partial sequences of PP_5257 (amaA) and PP_5259
  • Species
    Pseudomonas putida KT2440
  • Insert Size (bp)
    1513
  • Mutation
    none
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tatagtcctgtcgggtttcg
  • 3′ sequencing primer cttcccaaccttaccagag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIAR008 was a gift from Gregg Beckham (Addgene plasmid # 217023 ; http://n2t.net/addgene:217023 ; RRID:Addgene_217023)
  • For your References section:

    Production of Vanillin From Ferulic Acid by Pseudomonas putida KT2440 Using Metabolic Engineering and In Situ Product Recovery. Ruhl IA, Woodworth SP, Haugen SJ, Alt HM, Beckham GT, Johnson CW. Microb Biotechnol. 2025 May;18(5):e70152. doi: 10.1111/1751-7915.70152. 10.1111/1751-7915.70152 PubMed 40410945