pIAR010
(Plasmid
#217025)
-
Purposedeletion of modABC
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217025 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepK18sB
- Backbone size w/o insert (bp) 3038
- Total vector size (bp) 4526
-
Modifications to backbonedeletion of 45 bps during digestion and insert assembly
-
Vector typeBacterial gene replacement
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions50 μg/mL of kanamycin
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepartial sequences of PP_3827 (yrpB) and PP_3831
-
SpeciesPseudomonas putida KT2440
-
Insert Size (bp)1533
-
Mutationnone
-
Tag
/ Fusion Protein
- none
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tatagtcctgtcgggtttcg
- 3′ sequencing primer cttcccaaccttaccagag
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIAR010 was a gift from Gregg Beckham (Addgene plasmid # 217025 ; http://n2t.net/addgene:217025 ; RRID:Addgene_217025) -
For your References section:
Production of Vanillin From Ferulic Acid by Pseudomonas putida KT2440 Using Metabolic Engineering and In Situ Product Recovery. Ruhl IA, Woodworth SP, Haugen SJ, Alt HM, Beckham GT, Johnson CW. Microb Biotechnol. 2025 May;18(5):e70152. doi: 10.1111/1751-7915.70152. 10.1111/1751-7915.70152 PubMed 40410945