-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21719 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDsRed-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4000
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameE2-Orange
-
Alt nameDsRed
-
SpeciesDiscosoma
-
Insert Size (bp)678
-
GenBank IDFJ498891
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer cggacgcagatctcgagctcaagc (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pE2-Orange-N1 was a gift from Benjamin Glick (Addgene plasmid # 21719 ; http://n2t.net/addgene:21719 ; RRID:Addgene_21719) -
For your References section:
Noncytotoxic orange and red/green derivatives of DsRed-Express2 for whole-cell labeling. Strack RL, Bhattacharyya D, Glick BS, Keenan RJ. BMC Biotechnol. 2009 . 9():32. 10.1186/1472-6750-9-32 PubMed 19344508