Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-ITR-EcYtR-mCherry
(Plasmid #217362)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 217362 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-ITR-mCherry
  • Backbone manufacturer
    Cell Biolabs
  • Backbone size w/o insert (bp) 5486
  • Total vector size (bp) 5852
  • Modifications to backbone
    Replaced GFP with mCherry fluorescent reporter
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    E. coli tyrosine tRNA
  • Alt name
    EcYtR
  • Species
    Escherichia coli
  • Insert Size (bp)
    356
  • Promoter U6

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer CTGCGGCCGCACGCGTCTCGCGGTCCAG
  • 3′ sequencing primer GCTGCTCTCGTCGATCCGCTAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-ITR-EcYtR-mCherry was a gift from Abhishek Chatterjee (Addgene plasmid # 217362 ; http://n2t.net/addgene:217362 ; RRID:Addgene_217362)
  • For your References section:

    Virus-assisted directed evolution of enhanced suppressor tRNAs in mammalian cells. Jewel D, Kelemen RE, Huang RL, Zhu Z, Sundaresh B, Cao X, Malley K, Huang Z, Pasha M, Anthony J, van Opijnen T, Chatterjee A. Nat Methods. 2023 Jan;20(1):95-103. doi: 10.1038/s41592-022-01706-w. Epub 2022 Dec 22. 10.1038/s41592-022-01706-w PubMed 36550276