pLJC2-TK2-3xFLAG
              
              
                (Plasmid
                
                #217427)
              
            
            
            
          - 
            PurposeLentiviral overexpression of human TK2
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217427 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepLJC2
 - 
              Vector typeMammalian Expression, Lentiviral
 - 
                Selectable markersPuromycin
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)NEB Stable
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameTK2
 - 
                    SpeciesH. sapiens (human)
 - 
                  MutationInsert sequence is a codon-optimized gBLOCK (IDT)
 - 
                        Entrez GeneTK2 (a.k.a. MTDPS2, MTTK, PEOB3, SCA31, TK2-EXT)
 - Promoter CMV
 - 
    
        Tag
        / Fusion Protein
    
- 3xFLAG (C terminal on insert)
 
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site PacI (unknown if destroyed)
 - 3′ cloning site NotI (unknown if destroyed)
 - 5′ sequencing primer TGTACGGTGGGAGGTCTATATAAG
 - 3′ sequencing primer CCCTTTTCTTTTAAAATTGTGGATGAATACTGCC (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
Depositor Comments
Please visit https://doi.org/10.1101/2023.06.04.543621 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pLJC2-TK2-3xFLAG was a gift from Jason Cantor (Addgene plasmid # 217427 ; http://n2t.net/addgene:217427 ; RRID:Addgene_217427) - 
                
For your References section:
Conditional lethality profiling reveals anticancer mechanisms of action and drug-nutrient interactions. Flickinger KM, Wilson KM, Rossiter NJ, Hunger AL, Vishwasrao PV, Lee TD, Mellado Fritz CA, Richards RM, Hall MD, Cantor JR. Sci Adv. 2024 Oct 4;10(40):eadq3591. doi: 10.1126/sciadv.adq3591. Epub 2024 Oct 4. 10.1126/sciadv.adq3591 PubMed 39365851