pLentiCRISPR-v1-sgTK2_4
(Plasmid
#217431)
-
PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human TK2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217431 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLentiCRISPR v1
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA 4 targeting TK2
-
gRNA/shRNA sequenceAAGTCTCAGGATTGGTCCGA
-
SpeciesH. sapiens (human)
-
Entrez GeneTK2 (a.k.a. MTDPS2, MTTK, PEOB3, SCA31, TK2-EXT)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GTTTTAAAATGGACTATCATATGCTTACCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.06.04.543621 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPR-v1-sgTK2_4 was a gift from Jason Cantor (Addgene plasmid # 217431 ; http://n2t.net/addgene:217431 ; RRID:Addgene_217431) -
For your References section:
Conditional lethality profiling reveals anticancer mechanisms of action and drug-nutrient interactions. Flickinger KM, Wilson KM, Rossiter NJ, Hunger AL, Vishwasrao PV, Lee TD, Mellado Fritz CA, Richards RM, Hall MD, Cantor JR. Sci Adv. 2024 Oct 4;10(40):eadq3591. doi: 10.1126/sciadv.adq3591. Epub 2024 Oct 4. 10.1126/sciadv.adq3591 PubMed 39365851