Skip to main content

p2X-KSR1-CA3-EGFP (2x-C-KSR)
(Plasmid #217756)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 217756 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clonetech
  • Backbone size w/o insert (bp) 4600
  • Total vector size (bp) 4978
  • Modifications to backbone
    Insertion of 1st KSR1 CA3 domain (see plasmid pKSR1-CA3-EGFP)
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Kinase suppressor of ras 1 CA3 domain
  • Alt name
    KSR1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    321
  • Mutation
    Two tandem CA3 domain (aa 317-400) 1st linker GGSSGGGGA, 2nd LELKLRILQS (contains autophagy sequence)
  • GenBank ID
    XM_047436985
  • Entrez Gene
    KSR1 (a.k.a. KSR, RSU2)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GGTTCAGGGGGAGGTGTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p2X-KSR1-CA3-EGFP (2x-C-KSR) was a gift from Paula Nunes-Hasler (Addgene plasmid # 217756 ; http://n2t.net/addgene:217756 ; RRID:Addgene_217756)
  • For your References section:

    Development of Genetically Encoded Fluorescent KSR1-Based Probes to Track Ceramides during Phagocytosis. Girik V, van Ek L, Dentand Quadri I, Azam M, Cruz Cobo M, Mandavit M, Riezman I, Riezman H, Gavin AC, Nunes-Hasler P. Int J Mol Sci. 2024 Mar 5;25(5):2996. doi: 10.3390/ijms25052996. 10.3390/ijms25052996 PubMed 38474242