pSET-EMD-EGFP (C-SET-EMD)
(Plasmid
#217764)
-
PurposeFluorescent reporter for ceramide (putative, mammalian expression)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217764 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 4600
- Total vector size (bp) 4978
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSET
-
Alt nameI2PP2A
-
Alt nameIGAAD
-
Alt namePHAPII
-
SpeciesH. sapiens (human)
-
Insert Size (bp)475
-
MutationEMD domain (aa 70-226)
-
GenBank IDNM_001122821.2
-
Entrez GeneSET (a.k.a. 2PP2A, I2PP2A, IGAAD, IPP2A2, MRD58, PHAPII, TAF-I, TAF-IBETA)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GGTTCAGGGGGAGGTGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSET-EMD-EGFP (C-SET-EMD) was a gift from Paula Nunes-Hasler (Addgene plasmid # 217764 ; http://n2t.net/addgene:217764 ; RRID:Addgene_217764) -
For your References section:
Development of Genetically Encoded Fluorescent KSR1-Based Probes to Track Ceramides during Phagocytosis. Girik V, van Ek L, Dentand Quadri I, Azam M, Cruz Cobo M, Mandavit M, Riezman I, Riezman H, Gavin AC, Nunes-Hasler P. Int J Mol Sci. 2024 Mar 5;25(5):2996. doi: 10.3390/ijms25052996. 10.3390/ijms25052996 PubMed 38474242