Skip to main content

pETM11-SUMO3-KSR1-CA3-sfGFP (C-KSR)
(Plasmid #217766)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 217766 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pETM11-SUMO3
  • Backbone manufacturer
    EMBL
  • Backbone size w/o insert (bp) 6290
  • Total vector size (bp) 6600
  • Vector type
    Bacterial Expression ; Protein purification (6xHis tag, TEV site, SUMO3 tag)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Kinase suppressor of ras 1 CA3 domain
  • Alt name
    KSR1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    321
  • Mutation
    CA3 domain aa 317-400 plus vector-based linker LELKLRILQS (contains autophagy sequence)
  • GenBank ID
    XM_047436985
  • Entrez Gene
    KSR1 (a.k.a. KSR, RSU2)
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • sfGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer TCCCGCGAAATTAATACG
  • 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The pETM11-SUMO3-sfGFP plasmid was sourced from EMBL

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pETM11-SUMO3-KSR1-CA3-sfGFP (C-KSR) was a gift from Paula Nunes-Hasler (Addgene plasmid # 217766 ; http://n2t.net/addgene:217766 ; RRID:Addgene_217766)
  • For your References section:

    Development of Genetically Encoded Fluorescent KSR1-Based Probes to Track Ceramides during Phagocytosis. Girik V, van Ek L, Dentand Quadri I, Azam M, Cruz Cobo M, Mandavit M, Riezman I, Riezman H, Gavin AC, Nunes-Hasler P. Int J Mol Sci. 2024 Mar 5;25(5):2996. doi: 10.3390/ijms25052996. 10.3390/ijms25052996 PubMed 38474242