pETM11-SUMO3-KSR1-CA3-sfGFP (C-KSR)
(Plasmid
#217766)
-
PurposeFluorescent reporter for ceramide (for bacterial expression and purification)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217766 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepETM11-SUMO3
-
Backbone manufacturerEMBL
- Backbone size w/o insert (bp) 6290
- Total vector size (bp) 6600
-
Vector typeBacterial Expression ; Protein purification (6xHis tag, TEV site, SUMO3 tag)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKinase suppressor of ras 1 CA3 domain
-
Alt nameKSR1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)321
-
MutationCA3 domain aa 317-400 plus vector-based linker LELKLRILQS (contains autophagy sequence)
-
GenBank IDXM_047436985
-
Entrez GeneKSR1 (a.k.a. KSR, RSU2)
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- sfGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer TCCCGCGAAATTAATACG
- 3′ sequencing primer TGCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe pETM11-SUMO3-sfGFP plasmid was sourced from EMBL
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETM11-SUMO3-KSR1-CA3-sfGFP (C-KSR) was a gift from Paula Nunes-Hasler (Addgene plasmid # 217766 ; http://n2t.net/addgene:217766 ; RRID:Addgene_217766) -
For your References section:
Development of Genetically Encoded Fluorescent KSR1-Based Probes to Track Ceramides during Phagocytosis. Girik V, van Ek L, Dentand Quadri I, Azam M, Cruz Cobo M, Mandavit M, Riezman I, Riezman H, Gavin AC, Nunes-Hasler P. Int J Mol Sci. 2024 Mar 5;25(5):2996. doi: 10.3390/ijms25052996. 10.3390/ijms25052996 PubMed 38474242