Skip to main content

mouse a5 full length
(Plasmid #217810)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 217810 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pD2529 CAG
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ITGA5
  • Alt name
    Integrin alpha 5
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Itga5 (a.k.a. Cd49e, Fnra, VLA5)
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTTGATCGAAGCCGTCTCAG
  • 3′ sequencing primer TGAGGTCTCTAAAAGCGTCTTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.01.26.577394 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mouse a5 full length was a gift from Timothy Springer (Addgene plasmid # 217810 ; http://n2t.net/addgene:217810 ; RRID:Addgene_217810)
  • For your References section:

    Synthetic integrin antibodies discovered by yeast display reveal alphaV subunit pairing preferences with beta subunits. Hao Y, Yan J, Fraser C, Jiang A, Anuganti M, Zhang R, Lloyd K, Jardine J, Coppola J, Meijers R, Li J, Springer TA. MAbs. 2024 Jan-Dec;16(1):2365891. doi: 10.1080/19420862.2024.2365891. Epub 2024 Jun 18. 10.1080/19420862.2024.2365891 PubMed 38889315