mouse a2b full length
(Plasmid
#217812)
-
PurposeFull length mouse integrin a2b expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217812 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepD2529 CAG
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameITGA2B
-
Alt nameIntegrin alpha 2b
-
SpeciesM. musculus (mouse)
-
Entrez GeneItga2b (a.k.a. CD41, CD41B, GpIIb, alphaIIb)
- Promoter CAG
-
Tag
/ Fusion Protein
- P2A-EGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTCCTACAGCTCCTGGGCAAC
- 3′ sequencing primer AACAGTTCTGCGCCCTTAGA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.01.26.577394 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mouse a2b full length was a gift from Timothy Springer (Addgene plasmid # 217812 ; http://n2t.net/addgene:217812 ; RRID:Addgene_217812) -
For your References section:
Synthetic integrin antibodies discovered by yeast display reveal alphaV subunit pairing preferences with beta subunits. Hao Y, Yan J, Fraser C, Jiang A, Anuganti M, Zhang R, Lloyd K, Jardine J, Coppola J, Meijers R, Li J, Springer TA. MAbs. 2024 Jan-Dec;16(1):2365891. doi: 10.1080/19420862.2024.2365891. Epub 2024 Jun 18. 10.1080/19420862.2024.2365891 PubMed 38889315