mouse b6 full length
(Plasmid
#217816)
-
PurposeFull length mouse integrin b6 expression
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217816 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepD2529 CAG
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameITGB6
-
Alt nameIntegrin beta 6
-
SpeciesM. musculus (mouse)
-
Entrez GeneItgb6 (a.k.a. 2210409C20Rik, 4831415H04Rik)
- Promoter CAG
-
Tag
/ Fusion Protein
- P2A-mCherry (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTCCTACAGCTCCTGGGCAAC
- 3′ sequencing primer CATGTGCACCTTGAAGCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mouse b6 full length was a gift from Timothy Springer (Addgene plasmid # 217816 ; http://n2t.net/addgene:217816 ; RRID:Addgene_217816) -
For your References section:
Synthetic integrin antibodies discovered by yeast display reveal αV subunit pairing preferences with β subunits. Yuxin Hao, Jiabin Yan, Courtney Fraser, Aiping Jiang, Murali Anuganti, Roushu Zhang, Kenneth Lloyd, Joseph Jardine, Jessica Coppola, Rob Meijers, Jing Li, Timothy A.. bioRxiv 2024.01.26.577394 10.1101/2024.01.26.577394