Skip to main content

pET28b-ptetO::bac::gfp
(Plasmid #217882)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 217882 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28b-ptetO
  • Backbone size w/o insert (bp) 6598
  • Total vector size (bp) 16048
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Grow in TB medium, grow at 37 °C until OD600=0.8, then induce with tetracycline and shake at 20°C
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Dehydrogenase
  • Alt name
    SagB/ThcOx-family dehydrogenase
  • Species
    Bacillus cereus DSM 28590
  • Insert Size (bp)
    978
  • GenBank ID
    MBR9672240.1
  • Promoter ptetO

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCCGACCTCATTAAGCAGC
  • 3′ sequencing primer TGACGACAAGACCTACGTTCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Non-ribosomal peptide synthetase
  • Species
    Bacillus cereus DSM 28590
  • Insert Size (bp)
    7017
  • GenBank ID
    WP_048558486.1
  • Promoter ptetO

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTTGCTATCACGGATTACGAAG
  • 3′ sequencing primer AAATGAGGATGATCCACATGAG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Aminotransferase
  • Alt name
    aminotransferase class I/II-fold pyridoxalphosphate-dependent enzyme
  • Species
    Bacillus cereus DSM 28590
  • Insert Size (bp)
    1455
  • GenBank ID
    WP_000162820.1
  • Promoter ptetO

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACCTGCCCAATTAGGAATTGTTAC
  • 3′ sequencing primer TTACCGTTGGTCGCATCACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28b-ptetO::bac::gfp was a gift from Tobias A. M. Gulder (Addgene plasmid # 217882 ; http://n2t.net/addgene:217882 ; RRID:Addgene_217882)
  • For your References section:

    Bacillamide D produced by Bacillus cereus from the mouse intestinal bacterial collection (miBC) is a potent cytotoxin in vitro. Hohmann M, Brunner V, Johannes W, Schum D, Carroll LM, Liu T, Sasaki D, Bosch J, Clavel T, Sieber SA, Zeller G, Tschurtschenthaler M, Janssen KP, Gulder TAM. Commun Biol. 2024 May 28;7(1):655. doi: 10.1038/s42003-024-06208-3. 10.1038/s42003-024-06208-3 PubMed 38806706