Skip to main content

pMBS-858
(Plasmid #218008)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 218008 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAGM1287
  • Backbone manufacturer
    Sylvestre Marillonnet (Addgene plasmid #47996)
  • Backbone size w/o insert (bp) 2845
  • Total vector size (bp) 2967
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mVenus
  • Species
    Synthetic
  • Insert Size (bp)
    724

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer CAATACGCAAACCGCCTCTCC
  • 3′ sequencing primer AATAGGCGTATCACGAGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Level 0 MoClo Part Position B3-B4, insert can be released via BsaI digest

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMBS-858 was a gift from Michael Schroda (Addgene plasmid # 218008 ; http://n2t.net/addgene:218008 ; RRID:Addgene_218008)
  • For your References section:

    A Modular Cloning Toolkit for the production of recombinant proteins in Leishmania tarentolae. Hieronimus K, Donauer T, Klein J, Hinkel B, Spanle JV, Probst A, Niemeyer J, Kibrom S, Kiefer AM, Schneider L, Husemann B, Bischoff E, Mohring S, Bayer N, Klein D, Engels A, Ziehmer BG, Stiebeta J, Moroka P, Schroda M, Deponte M. Microb Cell. 2024 Apr 30;11:128-142. doi: 10.15698/mic2024.04.821. eCollection 2024. 10.15698/mic2024.04.821 PubMed 38799406