Skip to main content
Addgene

pSCBE3-NG
(Plasmid #218159)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 218159 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSCBE3
  • Backbone manufacturer
    Jian Wang
  • Backbone size w/o insert (bp) 8525
  • Vector type
    Bacterial Expression, CRISPR ; sgRNA transcription

Growth in Bacteria

  • Bacterial Resistance(s)
    Apramycin, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    scbe3-NG
  • Species
    S. coelicolor (bacteria)
  • Insert Size (bp)
    5100
  • Mutation
    Mutations in the portion of SpCas9 : D10A / L1111R / D1135V / G1218R / E1219F / A1322R / R1335V / T1337R.
  • Promoter rpsL promoter

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCTGCTCTCACGCAACGTCTAC
  • 3′ sequencing primer ATCCGCTTGCCCTCATCTGT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    a programmable sgRNA cloning cassette
  • Species
    Synthetic

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Original clone

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Another insert : a programmable sgRNA cloning cassette

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSCBE3-NG was a gift from Yuhui Sun (Addgene plasmid # 218159 ; http://n2t.net/addgene:218159 ; RRID:Addgene_218159)
  • For your References section:

    Engineered cytosine base editor enabling broad-scope and high-fidelity gene editing in Streptomyces. Wang J, Wang K, Deng Z, Zhong Z, Sun G, Mei Q, Zhou F, Deng Z, Sun Y. Nat Commun. 2024 Jul 7;15(1):5687. doi: 10.1038/s41467-024-49987-3. 10.1038/s41467-024-49987-3 PubMed 38971862