pNoT7
(Plasmid
#218168)
-
PurposepET31b plasmid with short insert lacking T7 and ribosome binding sites as control
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 218168 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET31b+
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameShort sequence, mutated RBS and T7 sites
- Promoter NA - mutated T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglIII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer AGATCTCGATCCCGCGAAAT
- 3′ sequencing primer GCTAGTTATTGCTCAGCGGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNoT7 was a gift from Emily Weinert (Addgene plasmid # 218168 ; http://n2t.net/addgene:218168 ; RRID:Addgene_218168) -
For your References section:
Binding of 2',3'-Cyclic Nucleotide Monophosphates to Bacterial Ribosomes Inhibits Translation. Chauhan SS, Marotta NJ, Karls AC, Weinert EE. ACS Cent Sci. 2022 Nov 23;8(11):1518-1526. doi: 10.1021/acscentsci.2c00681. Epub 2022 Sep 21. 10.1021/acscentsci.2c00681 PubMed 36439312