Skip to main content

pNoT7
(Plasmid #218168)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 218168 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET31b+
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Short sequence, mutated RBS and T7 sites
  • Promoter NA - mutated T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglIII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer AGATCTCGATCCCGCGAAAT
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNoT7 was a gift from Emily Weinert (Addgene plasmid # 218168 ; http://n2t.net/addgene:218168 ; RRID:Addgene_218168)
  • For your References section:

    Binding of 2',3'-Cyclic Nucleotide Monophosphates to Bacterial Ribosomes Inhibits Translation. Chauhan SS, Marotta NJ, Karls AC, Weinert EE. ACS Cent Sci. 2022 Nov 23;8(11):1518-1526. doi: 10.1021/acscentsci.2c00681. Epub 2022 Sep 21. 10.1021/acscentsci.2c00681 PubMed 36439312