Skip to main content

apoBb.1-Dendra2
(Plasmid #218180)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 218180 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC57-Kan
  • Backbone manufacturer
    Genewiz
  • Backbone size w/o insert (bp) 2626
  • Total vector size (bp) 4651
  • Vector type
    TALEN

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    apoBb.1-Dendra2
  • Alt name
    ApoB-Dendra2
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    2025
  • Mutation
    inserts HA-Dendra2 sequence at C-terminus of apoBb.1
  • GenBank ID
    NM_001030062
  • Tag / Fusion Protein
    • fuses HA-Dendra2 to apoBb.1 (C terminal on insert)

Cloning Information

  • Cloning method Gene Synthesis
  • 5′ sequencing primer CTGCCTGGAATGAATGAAGC
  • 3′ sequencing primer CTTACAAACTGATGTCTGCCTTACC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    ordered from Genewiz as GeneSynthesis product as PriorityGENE type

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

On this plasmid encoded is the C-terminal sequence of apoBb.1 (zebrafish ortholog of APOB) spanning the region of the TALEN homology region. followed by an HA-tag, then by a 4-Gly linker, and then the Dendra2 sequence with a STOP at the end, followed by the UTR of apoBb1 which servers as TALEN homology region.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    apoBb.1-Dendra2 was a gift from Steven Farber (Addgene plasmid # 218180 ; http://n2t.net/addgene:218180 ; RRID:Addgene_218180)
  • For your References section:

    Directly Measuring Atherogenic Lipoprotein Kinetics in Zebrafish With the Photoconvertible LipoTimer Reporter. Moll TOC, Kiefer JG, Klemek ML, Wilson MH, Farber SA. Arterioscler Thromb Vasc Biol. 2025 Aug 21. doi: 10.1161/ATVBAHA.125.322969. 10.1161/ATVBAHA.125.322969 PubMed 40836916