1167A
(Plasmid
#218233)
-
PurposeHDR plasmid for inserting Ceratitis capitata transformer female intron into the white pupae gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218233 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePiggyBac
- Total vector size (bp) 9190
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameputative metabolite transport protein
-
gRNA/shRNA sequencegaacgtaaagcgattggtgaggg
-
SpeciesC. capitata
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1167A was a gift from Omar Akbari (Addgene plasmid # 218233 ; http://n2t.net/addgene:218233 ; RRID:Addgene_218233)