Skip to main content
Addgene

pLentiCRISPRv2_sgALDH7A1
(Plasmid #218273)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 218273 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLentiCRISPRv2
  • Backbone size w/o insert (bp) 14873
  • Total vector size (bp) 13021
  • Modifications to backbone
    Inserted the ALDH7A1 targeted sgRNA sequence: ATTGAGCAGTGGAATCCCGT using BsmB1
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Inserted sgRNA targetting ALDH7A1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    29
  • Entrez Gene
    ALDH7A1 (a.k.a. ATQ1, EPD, EPEO4, PDE)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmB1 (not destroyed)
  • 3′ cloning site BsmB1 (not destroyed)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRv2_sgALDH7A1 was a gift from Seth Parker (Addgene plasmid # 218273 ; http://n2t.net/addgene:218273 ; RRID:Addgene_218273)
  • For your References section:

    Restricting lysine normalizes toxic catabolites associated with ALDH7A1 deficiency in cells and mice. Johal AS, Al-Shekaili HH, Abedrabbo M, Kehinde AZ, Towriss M, Koe JC, Hewton KG, Thomson SB, Ciernia AV, Leavitt B, Parker SJ. Cell Rep. 2024 Dec 24;43(12):115069. doi: 10.1016/j.celrep.2024.115069. Epub 2024 Dec 10. 10.1016/j.celrep.2024.115069 PubMed 39661514