pLentiCRISPRv2_sgALDH7A1
(Plasmid
#218273)
-
PurposeCRISPR KO plasmid for ALDH7A1 in human cell lines
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 218273 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLentiCRISPRv2
- Backbone size w/o insert (bp) 14873
- Total vector size (bp) 13021
-
Modifications to backboneInserted the ALDH7A1 targeted sgRNA sequence: ATTGAGCAGTGGAATCCCGT using BsmB1
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameInserted sgRNA targeting ALDH7A1
-
gRNA/shRNA sequenceATTGAGCAGTGGAATCCCGT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)29
-
Entrez GeneALDH7A1 (a.k.a. ATQ1, EPD, EPEO4, PDE)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmB1 (not destroyed)
- 3′ cloning site BsmB1 (not destroyed)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPRv2_sgALDH7A1 was a gift from Seth Parker (Addgene plasmid # 218273 ; http://n2t.net/addgene:218273 ; RRID:Addgene_218273) -
For your References section:
Restricting lysine normalizes toxic catabolites associated with ALDH7A1 deficiency in cells and mice. Johal AS, Al-Shekaili HH, Abedrabbo M, Kehinde AZ, Towriss M, Koe JC, Hewton KG, Thomson SB, Ciernia AV, Leavitt B, Parker SJ. Cell Rep. 2024 Dec 24;43(12):115069. doi: 10.1016/j.celrep.2024.115069. Epub 2024 Dec 10. 10.1016/j.celrep.2024.115069 PubMed 39661514