Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more


(Plasmid #218426)


Item Catalog # Description Quantity Price (USD)
Plasmid 218426 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Thermo Fisher
  • Backbone size w/o insert (bp) 5049
  • Total vector size (bp) 6510
  • Modifications to backbone
    Part of MCS removed (TTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGA), --> PmeI site followed by PspOMI site (TTTAAACGGGCCC), second PmeI site removed (gt --> ac) downstream of ApaI site
  • Vector type
    Mammalian Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human); Entacmaea quadricolor
  • Insert Size (bp)
  • Mutation
    5X: K2A, K13A, R15A, K20A, K23A mutations of both GABARAPs, G116A mutation of upstream GABARAP
  • Entrez Gene
    GABARAP (a.k.a. ATG8A, GABARAP-a, MM46)
  • Promoter CMV
  • Tag / Fusion Protein
    • mTagBFP2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmeI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer CMV-fw
  • 3′ sequencing primer BGH-rev
  • (Common Sequencing Primers)

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5/FRT/TO GABARAP(5X/G116A)-mTagBFP2-GABARAP(5X) was a gift from Dieter Willbold (Addgene plasmid # 218426 ; ; RRID:Addgene_218426)
  • For your References section:

    Highlighting the hidden: monitoring the avidity-driven association of a fluorescent GABARAP tandem with microtubules in living cells. Üffing A, Gold L, Gensch T, Weiergräber OH, Hoffmann S, Willbold D. Autophagy Reports, 3(1). doi: 10.1080/27694127.2024.2348899 10.1080/27694127.2024.2348899