Skip to main content

Halo-BASU-His
(Plasmid #218451)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 218451 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMG211
  • Backbone size w/o insert (bp) 4540
  • Total vector size (bp) 6268
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HaloTag-BASU-His fusion protein
  • Species
    Bacillus subtilis, Rhodococcus rhodochrous
  • Insert Size (bp)
    1728
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GCGGATAACAATTCCCCTCTAG
  • 3′ sequencing primer CAAGACCCGTTTAGAGGCCCCAAG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Halo-BASU-His was a gift from Thorsten Stafforst (Addgene plasmid # 218451 ; http://n2t.net/addgene:218451 ; RRID:Addgene_218451)
  • For your References section:

    Profiling the interactome of oligonucleotide drugs by proximity biotinylation. Hanswillemenke A, Hofacker DT, Sorgenfrei M, Fruhner C, Franz-Wachtel M, Schwarzer D, Macek B, Stafforst T. Nat Chem Biol. 2024 Jan 17. doi: 10.1038/s41589-023-01530-z. 10.1038/s41589-023-01530-z PubMed 38233583