Xlone Puro SNAP-eGFP-BASU
(Plasmid
#218452)
-
Purposeexpresses the SNAP-eGFP-BASU fusion protein via stable PiggyBac integration
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 218452 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC57
- Backbone size w/o insert (bp) 5817
- Total vector size (bp) 7908
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSNAP-eGFP-BASU
-
SpeciesH. sapiens (human); Bacillus subtilis, Aequorea victoria
-
Insert Size (bp)2091
- Promoter TRE3GS
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gctttgcttatgtaaaccaggg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Xlone Puro SNAP-eGFP-BASU was a gift from Thorsten Stafforst (Addgene plasmid # 218452 ; http://n2t.net/addgene:218452 ; RRID:Addgene_218452) -
For your References section:
Profiling the interactome of oligonucleotide drugs by proximity biotinylation. Hanswillemenke A, Hofacker DT, Sorgenfrei M, Fruhner C, Franz-Wachtel M, Schwarzer D, Macek B, Stafforst T. Nat Chem Biol. 2024 Jan 17. doi: 10.1038/s41589-023-01530-z. 10.1038/s41589-023-01530-z PubMed 38233583