pKSEe401R
(Plasmid
#218532)
-
Purpose(Empty Backbone) CRISPR/Cas9 genome editing vector pKSEe401R contains the maize codon-optimized Cas9 (zCas9) enhanced by the 5′-UTR fragment of OsMac3 and the pAtUBQ10-DsRED1-NOSt screening cassette in the backbone.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 218532 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepKSE401
-
Backbone manufacturerQi-Jun Chen (Addgene plasmid # 62202)
- Backbone size (bp) 18202
-
Modifications to backbonepKSEe401R contains the maize codon-optimized Cas9 (zCas9) enhanced by the 5′-UTR fragment of OsMac3 and the pAtUBQ10-DsRED1-NOSt screening cassette in the backbone.
-
Vector typePlant Expression
-
Selectable markersNeomycin (select with G418) ; pAtUBQ10-DsRED1
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin and Spectinomycin, 50 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsUse kanamycin (50 mkg/ml) together with spectinomycin (50 mkg/ml) for empty plasmid propagation both in E. coli and in Agrobacterium strains. Spectinomycin allows saving the pressure against BsaI-containing cassette.
-
Copy numberHigh Copy
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer 35S prom: CTATCCTTCGCAAGACCCTTC; M13/pUC For: CCCAGTCACGACGTTGTAAAACG; DsRed1-N: GTACTGGAACTGGGGGGACAG
- 3′ sequencing primer M13 Rev: CAGGAAACAGCTATGAC; DsRed1-C: AGCTGGACATCACCTCCCACAACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
As pKSEe401R is the modified version of original pKSE401 [Xing et al., 2014. BMC Plant Biology 14: 1-12], it allows to construct vectors expressing ONLY one gRNA for gene targeting. You may use original pCBC-DT1T2, pCBC-DT2T3, and pCBC-DT3T4 (AddGene IDs: 50590, 50591, 50592, respectively) for construction two-, three-, or four-gRNA-expressing vectors.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKSEe401R was a gift from Kirill Demchenko (Addgene plasmid # 218532 ; http://n2t.net/addgene:218532 ; RRID:Addgene_218532) -
For your References section:
Do DEEPER ROOTING 1 Homologs Regulate the Lateral Root Slope Angle in Cucumber (Cucumis sativus)?. Kiryushkin AS, Ilina EL, Kiikova TY, Pawlowski K, Demchenko KN. Int J Mol Sci. 2024 Feb 6;25(4):1975. doi: 10.3390/ijms25041975. 10.3390/ijms25041975 PubMed 38396652