pJET1.2-OsMac3
(Plasmid #218542)

• Purpose: Vector pJET1.2 contains the 158-bp 5′-UTR fragment (from −158 to −1 bp before the ATG) of OsMac3 from Japonica rice genomic DNA.
• Depositing Lab: Kirill Demchenko
• Publication: Kiryushkin et al Int J Mol Sci. 2024 Feb 6;25(4):1975. doi: 10.3390/ijms25041975.

Backbone

• Vector backbone: pJET1.2
• Backbone manufacturer: Thermo Fisher Scientific
• Backbone size w/o insert (bp): 2990
• Total vector size (bp): 3148
• Modifications to backbone: Cloning vector pJET1.2 with the 158-bp 5′-UTR fragment insert of OsMac3 from Japonica rice genomic DNA.
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 158-bp 5′-UTR fragment (from −158 to −1 bp before the ATG) of OsMac3 from Japonica rice genomic DNA.
• Alt name: dMac3
• Species: Oryza sativa subsp. japonica (Japonica rice)
• Insert Size (bp): 158
• GenBank ID: XM_026025680.1 XM_015784948.2

Cloning Information

• Cloning method: Other
• 5′ sequencing primer: pJET For: CGACTCACTATAGGGAGAGCGGC
• 3′ sequencing primer: pJET Rev: AAGAACATCGATTTTCCATGGCAG

Resource Information

• Supplemental Documents:
  • pJET1.2-OsMac3.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The OsMac3 5′-UTR fragment (from −158 to −1 bp before the ATG) was shown to exhibit sufficient activity as a translational enhancer [Aoki et al., 2014. Plant Biotechnology. 31: 221-228] and can be used to improve genome editing in both monocots [Onodera et al., 2018. PLOS ONE. 13: 1-13] and dicots [Kusano et al., 2018. Scientific Reports 8: 1-9; Kusano et al., 2023. Plant Biotechnology. 40: 201-209].
The OsMac3 IDs are as follows: LOC_Os05g44080.1 or LOC_Os05g44080.2 (Phytozome v 13, Oryza sativa v7.0); Os05g0516900 (UniProt, Oryza sativa subsp. japonica).