pJET1.2-OsMac3
(Plasmid
#218542)
-
PurposeVector pJET1.2 contains the 158-bp 5′-UTR fragment (from −158 to −1 bp before the ATG) of OsMac3 from Japonica rice genomic DNA.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 218542 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJET1.2
-
Backbone manufacturerThermo Fisher Scientific
- Backbone size w/o insert (bp) 2990
- Total vector size (bp) 3148
-
Modifications to backboneCloning vector pJET1.2 with the 158-bp 5′-UTR fragment insert of OsMac3 from Japonica rice genomic DNA.
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name158-bp 5′-UTR fragment (from −158 to −1 bp before the ATG) of OsMac3 from Japonica rice genomic DNA.
-
Alt namedMac3
-
SpeciesOryza sativa subsp. japonica (Japonica rice)
-
Insert Size (bp)158
-
GenBank IDXM_026025680.1 XM_015784948.2
Cloning Information
- Cloning method Other
- 5′ sequencing primer pJET For: CGACTCACTATAGGGAGAGCGGC
- 3′ sequencing primer pJET Rev: AAGAACATCGATTTTCCATGGCAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The OsMac3 5′-UTR fragment (from −158 to −1 bp before the ATG) was shown to exhibit sufficient activity as a translational enhancer [Aoki et al., 2014. Plant Biotechnology. 31: 221-228] and can be used to improve genome editing in both monocots [Onodera et al., 2018. PLOS ONE. 13: 1-13] and dicots [Kusano et al., 2018. Scientific Reports 8: 1-9; Kusano et al., 2023. Plant Biotechnology. 40: 201-209].
The OsMac3 IDs are as follows: LOC_Os05g44080.1 or LOC_Os05g44080.2 (Phytozome v 13, Oryza sativa v7.0); Os05g0516900 (UniProt, Oryza sativa subsp. japonica).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJET1.2-OsMac3 was a gift from Kirill Demchenko (Addgene plasmid # 218542 ; http://n2t.net/addgene:218542 ; RRID:Addgene_218542) -
For your References section:
Do DEEPER ROOTING 1 Homologs Regulate the Lateral Root Slope Angle in Cucumber (Cucumis sativus)?. Kiryushkin AS, Ilina EL, Kiikova TY, Pawlowski K, Demchenko KN. Int J Mol Sci. 2024 Feb 6;25(4):1975. doi: 10.3390/ijms25041975. 10.3390/ijms25041975 PubMed 38396652