pHMTc-FBF-2 (121-632)
(Plasmid
#218664)
-
PurposeExpression of MBP:6xHIS:FBF-2(121-632)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218664 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHMTC
- Backbone size w/o insert (bp) 7688
- Total vector size (bp) 8199
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namefbf-2
-
Alt nameBH97
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)511
-
Mutationamino acids 121-632 only
-
Entrez Genefbf-2 (a.k.a. CELE_F21H12.5)
-
Tag
/ Fusion Protein
- MBP-6xHIS (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Eco RI (unknown if destroyed)
- 3′ cloning site Sal I (unknown if destroyed)
- 5′ sequencing primer gtcgcaaattgtcgcggcga
- 3′ sequencing primer tcgccgcgacaatttgcgac (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHMTc-FBF-2 (121-632) was a gift from Judith Kimble (Addgene plasmid # 218664 ; http://n2t.net/addgene:218664 ; RRID:Addgene_218664) -
For your References section:
PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans. Carrick BH, Crittenden SL, Chen F, Linsley M, Woodworth J, Kroll-Conner P, Ferdous AS, Keles S, Wickens M, Kimble J. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. Epub 2024 Jan 29. 10.1016/j.devcel.2024.01.005 PubMed 38290520