Skip to main content

pFB-6HZB
(Plasmid #218680)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 218680 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFB-6HZB
  • Backbone manufacturer
    Pravin Mahajan, SGC
  • Vector type
    Insect Expression ; pFB
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • His-Z-TEV (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TATTCATACCGTCCCACCA
  • 3′ sequencing primer GGGAGGTTTTTTAAAGCAAGTAAA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Pravin Mahajan, SGC

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFB-6HZB was a gift from Sebastian Mathea (Addgene plasmid # 218680 ; http://n2t.net/addgene:218680 ; RRID:Addgene_218680)