Skip to main content

pCAG-EGFP-C-IFT46
(Plasmid #218724)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 218724 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG-EGFP-C
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6767
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IFT46
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    355
  • Entrez Gene
    IFT46 (a.k.a. C11orf2, C11orf60, CFAP32)
  • Promoter CAG
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CTGAGCAAAGACCCCAACGAG
  • 3′ sequencing primer GCCAGAAGTCAGATGCTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-EGFP-C-IFT46 was a gift from Kazuhisa Nakayama (Addgene plasmid # 218724 ; http://n2t.net/addgene:218724 ; RRID:Addgene_218724)
  • For your References section:

    Overall architecture of the intraflagellar transport (IFT)-B complex containing Cluap1/IFT38 as an essential component of the IFT-B peripheral subcomplex. Katoh Y, Terada M, Nishijima Y, Takei R, Nozaki S, Hamada H, Nakayama K. J Biol Chem. 2016 Mar 15. pii: jbc.M116.713883. 10.1074/jbc.M116.713883 PubMed 26980730