Skip to main content
Addgene

pEGFP-C1-IFT54
(Plasmid #218726)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 218726 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4731
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IFT54
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1998
  • Entrez Gene
    TRAF3IP1 (a.k.a. CFAP116, FAP116, IFT54, MIP-T3, MIPT3, SLSN9)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site XhoI/SalI (destroyed during cloning)
  • 5′ sequencing primer CTGAGCAAAGACCCCAACGAG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-C1-IFT54 was a gift from Kazuhisa Nakayama (Addgene plasmid # 218726 ; http://n2t.net/addgene:218726 ; RRID:Addgene_218726)
  • For your References section:

    Multiple interactions of the dynein-2 complex with the IFT-B complex are required for effective intraflagellar transport. Hiyamizu S, Qiu H, Vuolo L, Stevenson NL, Shak C, Heesom KJ, Hamada Y, Tsurumi Y, Chiba S, Katoh Y, Stephens DJ, Nakayama K. J Cell Sci. 2023 Mar 1;136(5):jcs260462. doi: 10.1242/jcs.260462. Epub 2023 Feb 7. 10.1242/jcs.260462 PubMed 36632779