Skip to main content

pEGFP-C1-IFT56
(Plasmid #218727)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 218727 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4731
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IFT56
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1296
  • Entrez Gene
    TTC26 (a.k.a. DYF13, dyf-13, FLJ12571, MGC163211)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII/BamHI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTGAGCAAAGACCCCAACGAG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-C1-IFT56 was a gift from Kazuhisa Nakayama (Addgene plasmid # 218727 ; http://n2t.net/addgene:218727 ; RRID:Addgene_218727)
  • For your References section:

    Regulation of ciliary retrograde protein trafficking by Joubert syndrome proteins ARL13B and INPP5E. Nozaki S, Katoh Y, Terada M, Michisaka S, Funabashi T, Takahashi S, Kontani K, Nakayama K. J Cell Sci. 2016 Dec 7. pii: jcs.197004. 10.1242/jcs.197004 PubMed 27927754