pEGFP-C1-IFT56
(Plasmid
#218727)
-
PurposeExpresses N-terminally EGFP-tagged IFT56 in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218727 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFT56
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1296
-
Entrez GeneTTC26 (a.k.a. DYF13, dyf-13, FLJ12571, MGC163211)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII/BamHI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CTGAGCAAAGACCCCAACGAG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C1-IFT56 was a gift from Kazuhisa Nakayama (Addgene plasmid # 218727 ; http://n2t.net/addgene:218727 ; RRID:Addgene_218727) -
For your References section:
Regulation of ciliary retrograde protein trafficking by Joubert syndrome proteins ARL13B and INPP5E. Nozaki S, Katoh Y, Terada M, Michisaka S, Funabashi T, Takahashi S, Kontani K, Nakayama K. J Cell Sci. 2016 Dec 7. pii: jcs.197004. 10.1242/jcs.197004 PubMed 27927754