pEGFP-C1-IFT57
(Plasmid
#218728)
-
PurposeExpresses N-terminally EGFP-tagged IFT57 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218728 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFT57
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1662
-
Entrez GeneIFT57 (a.k.a. ESRRBL1, HIPPI, MHS4R2, OFD18)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CTGAGCAAAGACCCCAACGAG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C1-IFT57 was a gift from Kazuhisa Nakayama (Addgene plasmid # 218728 ; http://n2t.net/addgene:218728 ; RRID:Addgene_218728) -
For your References section:
Interaction of heterotrimeric kinesin-II with IFT-B-connecting tetramer is crucial for ciliogenesis. Funabashi T, Katoh Y, Okazaki M, Sugawa M, Nakayama K. J Cell Biol. 2018 Aug 6;217(8):2867-2876. doi: 10.1083/jcb.201801039. Epub 2018 Jun 14. 10.1083/jcb.201801039 PubMed 29903877