pCAG-EGFP-C-IFT70B
(Plasmid
#218729)
-
PurposeExpresses N-terminally EGFP-tagged IFT70B in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218729 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCAG-EGFP-C
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6767
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFT70B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1878
-
Entrez GeneTTC30B (a.k.a. IFT70, IFT70B, fleer)
- Promoter CAG
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII/BamHI (destroyed during cloning)
- 3′ cloning site XhoI/SalI (destroyed during cloning)
- 5′ sequencing primer CTGAGCAAAGACCCCAACGAG
- 3′ sequencing primer GCCAGAAGTCAGATGCTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-EGFP-C-IFT70B was a gift from Kazuhisa Nakayama (Addgene plasmid # 218729 ; http://n2t.net/addgene:218729 ; RRID:Addgene_218729) -
For your References section:
Robust interaction of IFT70 with IFT52-IFT88 in the IFT-B complex is required for ciliogenesis. Takei R, Katoh Y, Nakayama K. Biol Open. 2018 Apr 30;7(5). pii: bio.033241. doi: 10.1242/bio.033241. 10.1242/bio.033241 PubMed 29654116