pEF-GalNAcT2-msYFP2
(Plasmid
#218963)
-
PurposeExpresses full length GalNAcT2-msYFP2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 218963 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEF
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGalNAcT2-msYFP2
-
SpeciesH. sapiens (human)
-
Entrez GeneGALNT2 (a.k.a. CDG2T, GalNAc-T2)
- Promoter EF1a
-
Tag
/ Fusion Protein
- msYFP2
Cloning Information
- Cloning method Other
- 5′ sequencing primer tttttttcttccatttcaggtgtcgtga
- 3′ sequencing primer tcgaggctgatcagcgagcttct (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF-GalNAcT2-msYFP2 was a gift from Benjamin Glick (Addgene plasmid # 218963 ; http://n2t.net/addgene:218963 ; RRID:Addgene_218963)