pcDNA5-3xFLAG-SRSF1 siRNA-resitant
(Plasmid
#218974)
-
PurposeVector for expressing siRNA-resistant SRSF1 cDNA (siRNA sequence: CGUGGAGUUUGUACGGAAA)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 218974 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA5-3xFLAG
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSRSF1 cDNA
-
SpeciesH. sapiens (human)
-
MutationsiRNA-resistant SRSF1 cDNA (siRNA sequence: CGUGGAGUUUGUACGGAAA)
- Promoter CMV
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer TTTAAACTTAAGCTTCCACC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5-3xFLAG-SRSF1 siRNA-resitant was a gift from Thomas Gonatopoulos-Pournatzis (Addgene plasmid # 218974 ; http://n2t.net/addgene:218974 ; RRID:Addgene_218974) -
For your References section:
Genome-scale exon perturbation screens uncover exons critical for cell fitness. Xiao MS, Damodaran AP, Kumari B, Dickson E, Xing K, On TA, Parab N, King HE, Perez AR, Guiblet WM, Duncan G, Che A, Chari R, Andresson T, Vidigal JA, Weatheritt RJ, Aregger M, Gonatopoulos-Pournatzis T. Mol Cell. 2024 Jul 11;84(13):2553-2572.e19. doi: 10.1016/j.molcel.2024.05.024. Epub 2024 Jun 24. 10.1016/j.molcel.2024.05.024 PubMed 38917794