Lifeact-mhYFP
(Plasmid
#218978)
-
PurposeIn vivo visualization of actin cytoskeleton
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 218978 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCS2+8
- Backbone size w/o insert (bp) 4137
- Total vector size (bp) 4922
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLifeact-mhYFP
-
SpeciesSynthetic
-
Insert Size (bp)789
- Promoter CMV
-
Tag
/ Fusion Protein
- mhYFP (C terminal on insert)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer TGACGTAAATGGGCGGTAGG
- 3′ sequencing primer CTCGCTCACTGACTCGCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lifeact-mhYFP was a gift from Amro Hamdoun (Addgene plasmid # 218978 ; http://n2t.net/addgene:218978 ; RRID:Addgene_218978)