Skip to main content

LvPolyUb
(Plasmid #218982)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 218982 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Twist Bioscience High Copy Amp
  • Backbone manufacturer
    Twist Bioscience
  • Backbone size w/o insert (bp) 2233
  • Total vector size (bp) 5672
  • Vector type
    sea urchin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    L.variegatus polyubiquitinC promoter
  • Species
    Synthetic; Lytechinus variegatus
  • Insert Size (bp)
    3439
  • Promoter L.variegatus polyubiquitinC promoter

Cloning Information

  • Cloning method Gene Synthesis
  • 5′ sequencing primer TGTAAAACGACGGCCAGT
  • 3′ sequencing primer AGCGGATAACAATTTCACACAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LvPolyUb was a gift from Amro Hamdoun (Addgene plasmid # 218982 ; http://n2t.net/addgene:218982 ; RRID:Addgene_218982)