pCMV-Myc-CEBPA
(Plasmid
#219393)
-
PurposeExpress CEBPA in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 219393 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCMV-Myc
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCEBPA
-
SpeciesH. sapiens (human)
-
Entrez GeneCEBPA (a.k.a. C/EBP-alpha, CEBP)
-
Tag
/ Fusion Protein
- N terminal Myc tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer AGGCCTGTACGGAAGTGTTACTT
- 3′ sequencing primer GTGGTTTGTCCAAACTCATCAATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-Myc-CEBPA was a gift from Yoichi Furukawa (Addgene plasmid # 219393 ; http://n2t.net/addgene:219393 ; RRID:Addgene_219393) -
For your References section:
Wnt/beta-catenin signaling regulates amino acid metabolism through the suppression of CEBPA and FOXA1 in liver cancer cells. Nakagawa S, Yamaguchi K, Takane K, Tabata S, Ikenoue T, Furukawa Y. Commun Biol. 2024 Apr 29;7(1):510. doi: 10.1038/s42003-024-06202-9. 10.1038/s42003-024-06202-9 PubMed 38684876