Skip to main content

pCMV-Myc-FOXA1
(Plasmid #219394)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219394 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV-Myc
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FOXA1
  • Species
    H. sapiens (human)
  • Entrez Gene
    FOXA1 (a.k.a. HNF3A, TCF3A)
  • Tag / Fusion Protein
    • N terminal Myc tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer AGGCCTGTACGGAAGTGTTACTT
  • 3′ sequencing primer GTGGTTTGTCCAAACTCATCAATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-Myc-FOXA1 was a gift from Yoichi Furukawa (Addgene plasmid # 219394 ; http://n2t.net/addgene:219394 ; RRID:Addgene_219394)
  • For your References section:

    Wnt/beta-catenin signaling regulates amino acid metabolism through the suppression of CEBPA and FOXA1 in liver cancer cells. Nakagawa S, Yamaguchi K, Takane K, Tabata S, Ikenoue T, Furukawa Y. Commun Biol. 2024 Apr 29;7(1):510. doi: 10.1038/s42003-024-06202-9. 10.1038/s42003-024-06202-9 PubMed 38684876