Skip to main content

pSCL390
(Plasmid #219500)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219500 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pZS157
  • Backbone manufacturer
    Addgene #114454
  • Backbone size w/o insert (bp) 10663
  • Total vector size (bp) 11323
  • Vector type
    Yeast Expression
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Integrating inducible cassette: Cas9-P2A-Csy4 and Eco1 RT
  • Species
    Synthetic
  • Insert Size (bp)
    6476
  • Promoter GAL1-GAL10
  • Tag / Fusion Protein
    • SV40-NLS (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAATTAACCCTCACTAAAGG
  • 3′ sequencing primer TAATACGACTCACTATAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Used Addgene items #114454 (pZS157) and #41583 (pCAGGS-mCherry).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSCL390 was a gift from Seth Shipman (Addgene plasmid # 219500 ; http://n2t.net/addgene:219500 ; RRID:Addgene_219500)
  • For your References section:

    Simultaneous multi-site editing of individual genomes using retron arrays. Gonzalez-Delgado A, Lopez SC, Rojas-Montero M, Fishman CB, Shipman SL. Nat Chem Biol. 2024 Nov;20(11):1482-1492. doi: 10.1038/s41589-024-01665-7. Epub 2024 Jul 9. 10.1038/s41589-024-01665-7 PubMed 38982310