pSCL390
(Plasmid
#219500)
-
PurposeIntegrating inducible cassette (Cas9-P2A-Csy4 and Eco1 RT) for yeast overexpression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219500 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepZS157
-
Backbone manufacturerAddgene #114454
- Backbone size w/o insert (bp) 10663
- Total vector size (bp) 11323
-
Vector typeYeast Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIntegrating inducible cassette: Cas9-P2A-Csy4 and Eco1 RT
-
SpeciesSynthetic
-
Insert Size (bp)6476
- Promoter GAL1-GAL10
-
Tag
/ Fusion Protein
- SV40-NLS (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAATTAACCCTCACTAAAGG
- 3′ sequencing primer TAATACGACTCACTATAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byUsed Addgene items #114454 (pZS157) and #41583 (pCAGGS-mCherry).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.07.17.549397v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSCL390 was a gift from Seth Shipman (Addgene plasmid # 219500 ; http://n2t.net/addgene:219500 ; RRID:Addgene_219500) -
For your References section:
Simultaneous multi-site editing of individual genomes using retron arrays. Gonzalez-Delgado A, Lopez SC, Rojas-Montero M, Fishman CB, Shipman SL. Nat Chem Biol. 2024 Nov;20(11):1482-1492. doi: 10.1038/s41589-024-01665-7. Epub 2024 Jul 9. 10.1038/s41589-024-01665-7 PubMed 38982310