pSCL475
(Plasmid
#219503)
-
PurposeExpress Ade2, Can1 and Faa1 retron msd donor-gRNAs from a single Gal7 promoter, separated by a Csy4 recognition sequence, with an msr expressed in trans
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219503 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSCL39
-
Backbone manufacturerAddgene #184973
- Backbone size w/o insert (bp) 5602
- Total vector size (bp) 6574
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAde2, Can1 and Faa1 retron msd donor-gRNAs separated by a Csy4 recognition sequence, with an msr expressed in trans
-
SpeciesSynthetic
-
Insert Size (bp)963
- Promoter GAL7
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer AGGTCGGAAATATTTATGGGCA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byUsed Addgene items #114454 (pZS157) and #41583 (pCAGGS-mCherry).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.07.17.549397v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSCL475 was a gift from Seth Shipman (Addgene plasmid # 219503 ; http://n2t.net/addgene:219503 ; RRID:Addgene_219503) -
For your References section:
Simultaneous multi-site editing of individual genomes using retron arrays. Gonzalez-Delgado A, Lopez SC, Rojas-Montero M, Fishman CB, Shipman SL. Nat Chem Biol. 2024 Nov;20(11):1482-1492. doi: 10.1038/s41589-024-01665-7. Epub 2024 Jul 9. 10.1038/s41589-024-01665-7 PubMed 38982310