Skip to main content

pAAV Syn 2xLyn-ERex-mKate2-bPAC(F198Y)
(Plasmid #219654)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219654 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene (Agilent)
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    2xLyn-ERex-mKate2-bPAC(F198Y)
  • Alt name
    PACmn
  • Species
    H. sapiens (human), Synthetic; Aequoria victoria/Beggiatoa
  • Insert Size (bp)
    1860
  • Promoter Syn
  • Tags / Fusion Proteins
    • Lyn11 (GCIKSKGKDS) (N terminal on insert)
    • ER exit ( FCYENE) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
  • 3′ sequencing primer GGCATTAAAGCAGCGTATCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is identical to #165491 but with mKate2 ( Far-red fluorescent protein) (Evrogen), the insert was assembled in the lab of Georg Nagel.

Please visit https://doi.org/10.1101/2024.02.16.580703 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV Syn 2xLyn-ERex-mKate2-bPAC(F198Y) was a gift from Thomas Oertner (Addgene plasmid # 219654 ; http://n2t.net/addgene:219654 ; RRID:Addgene_219654)