CasRx gRNA targeting EZH2
(Plasmid
#219655)
-
PurposehU6-driven expression of CasRx guide RNA targeting EZH2. 5' processed DR followed by EZH2 guide.
-
Depositing Lab
-
Depositing OrganizationUniversity of Chicago
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219655 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 219655-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 219655-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepBR322
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCasRx gRNA targeting EZH2
-
gRNA/shRNA sequenceGAGAGCAGCAGCAAACTCCTTTGCTCCCTC
Cloning Information
- Cloning method Other
- 5′ sequencing primer aaccaattcagtcgactgg
- 3′ sequencing primer TTTCCATAGGCTCCGCCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 219655-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 219655-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CasRx gRNA targeting EZH2 was a gift from Weixin Tang (Addgene plasmid # 219655 ; http://n2t.net/addgene:219655 ; RRID:Addgene_219655) -
For your References section:
Programmed RNA editing with an evolved bacterial adenosine deaminase. Yan H, Tang W. Nat Chem Biol. 2024 Jul 5. doi: 10.1038/s41589-024-01661-x. 10.1038/s41589-024-01661-x PubMed 38969862
Map uploaded by the depositor.
