CasRx gRNA targeting EZH2
(Plasmid
#219655)
-
PurposehU6-driven expression of CasRx guide RNA targeting EZH2. 5' processed DR followed by EZH2 guide.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219655 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBR322
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCasRx gRNA targeting EZH2
-
gRNA/shRNA sequenceGAGAGCAGCAGCAAACTCCTTTGCTCCCTC
Cloning Information
- Cloning method Other
- 5′ sequencing primer aaccaattcagtcgactgg
- 3′ sequencing primer TTTCCATAGGCTCCGCCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CasRx gRNA targeting EZH2 was a gift from Weixin Tang (Addgene plasmid # 219655 ; http://n2t.net/addgene:219655 ; RRID:Addgene_219655) -
For your References section:
Programmed RNA editing with an evolved bacterial adenosine deaminase. Yan H, Tang W. Nat Chem Biol. 2024 Jul 5. doi: 10.1038/s41589-024-01661-x. 10.1038/s41589-024-01661-x PubMed 38969862